My MtDNA Results

Armando,

Thanks for your clear explanation of DNA for me. I need someone that can come down to my level of understanding. When it comes to math, science, etc. I am like a not-so-smart 2nd grader.

I can see that I misunderstood the time that Haplogroup has been in the Americas. I kind of thought that was unusual, since mostly I have heard that Native Americans populated the Americas 10,000 years ago only.

I have a question still about the mutations. The A, T. C. and G, are those only for my haplogroup C or does everyone have those letters? Also does haplogroup C mean that my chemical base is cytocine---is that how they came up with the letters for the various haplogroups, the chemical bases?

Yes, you are right about people hesitating to provide their DNA for research--the fact that the science of it and terminology seem daunting. That was my reason---I couldn't understand "subclades" etc when people on Nuestros Ranchos started talking about it. In fact, had I not joined Nuestros Ranchos, I wouldn't even have been aware of DNA testing for genealogical purposes. Now there are shows on TV that kind of help inform people, but some people refuse for reasons unknown to participate in DNA testing. I am sure some whites don't like the discovery of Africans in their ancestry.

I know from my researching the records in Zacatecas that my father had mulatto blood as well as Basque and very little indio. Mostly the records on his male side say espanol. I have found nothing on his mother's side. He told me he was a mestizo. So does that mean that since my DNA follows only my female ancestors on my maternal side, that I will never know if I have mulato or Basque DNA?

Your explanation of mutations and that they occur from one person to another, and not that it occurs in the same person helped me a lot in understanding. (See, I told you my understanding is almost less than grade-school). I'm an artist and intuitive, not what you would call "rational".

I too am interested in Y-DNA though I will never know my father's (from Zacatecas) since he had no brothers and his uncles and male cousins are long gone and I don't know the younger generations. I only have a sister. I wanted to know from the Apaches what their DNA is, but they say that their elders do not want them to be studied that way, nor will they share their family trees; they say they are all "equal" and that family trees only serve to find out who is more elite than others. They also say descendancy is "matrilineal"? I thought that the BIA required that they be tested, but I guess they force them to do that---they fear being taken off the rolls and lose benefits if they don't have a certain "quantum" of Native blood?

I want to know about the Apaches because so many of my male cousins were never taught about their tribal history and think they are Apache, but I know they are not. We are Piro-Manso-Tewa, Pueblo tribes going back to the days of Onate, though the last person who knew the language and tribal history was my great-grandfather who was killed in 1900. My 98 year old Auntie in New Mexico knows the real story. All of our male ancestors fought the Apaches, and I have military records to show they belonged to local militias and were Army scouts who battled the Apaches before and after the Civil War. During the days of the Royal Army they served in the Presidios, again to protect the routes and people from "los indios barbaros".

I hope you don't mind my asking so many questions. Thank you again,

Emilie
Port Orchard, WA

-----------------------------------------------------------

> Date: Tue, 3 Jul 2012 22:44:37 -0500
> From: fandemma@gmail.com
> To: announce@nuestrosranchos.org
> Subject: Re: [Nuestros Ranchos] My MtDNA Results
>
> Hello Emilie,
>
> The colonization of the Americas happened about close to 15,000-18,000
> years ago and there were 15 founding mtDNA lineages according to the two
> following articles.
>
> http://www.sciencedaily.com/releases/2011/10/111020145054.htm
>
> http://www.sciencedaily.com/releases/2010/06/100628170926.htm
>
>
> Native American Y-DNA is also an interesting subject. Hopefully more
> studies will be realized with those groups in the coming years. In the
> following page they compare Sioux, Chippewa, Pima, Tarahumara, Nahua, and
> Otomí, and Qechua speakers.
>
> http://dienekes.blogspot.com/2012/05/y-chromosome-diversity-in-native.h…
>
>
> Your mtDNA haplogroup started 40,000 years ago and they determine that by a
> calculation of mutation rates. Your ancestor that had that first mutation
> lived in Asia and her descendants didn't cross the Bering Strait until
> 15,000-18,000 years ago. A mutation is the sudden change in genes or
> chromosomes between an organism or being and an offspring. This is what
> caused evolution. The beings with the mutations that were better suited to
> changes in the environment were the ones that survived. Mutations can be
> seen in the DNA because of sequences that change. These sequences are
> represented by the letters A, T, C, and G which stand for four chemical
> bases: adenine (A), guanine (G), cytosine (C), and thymine (T). The DNA
> strands with a string of letters like
> this:ATATTTGAAAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAG Certain areas of the
> DNA have
> certain sequences and when there is a difference between one person and
> another that is the mutation they are speaking of.
>
> I don't think mtDNA changes as often as Y-DNA which is why it is harder to
> find matches with people with the same surname apart from the fact that the
> population size has to be fairly large and there have to be enough people
> willing to test. Unfortunately there are too many people unwilling to test
> in all segments which slows the discovery process. We need more people
> willing to test and share the data. I think their inability to understand
> what can be derived from DNA or what it means keeps them from doing this.
> It is very sad really.
>
> Saludos
> Armando
>
> On Mon, Jul 2, 2012 at 9:26 PM, Emilie Garcia wrote:
>
> >
> > I just got my MtDNA results from FamilyTreeDNA.
> >
> > I am haplogroup C, which supposedly "is found in eastern Eurasia and
> > throughout the Americas. This haplogroup was present in the populations
> > that initially colonized the pre-Columbian Americas, and dates to at least
> > 40,000 years ago. Future work will resolve the issue of how many distinct
> > colonization events there were in the original peopling of the Americas,
> > and the role of individuals bearing haplogroup C." (Description used
> > without written permission).
> >
> > Eastern Eurasia. No wonder people from there mistake me for Filipino or
> > Thai. This happens frequently. I do have an Asian cast to my eyes.
> >
> > They also sent a map showing the migration of haplogroup C from eastern
> > Africa across Asia, over the Bering Straight, down Alaska and Canada, and
> > then to North, Central and South America.
> >
> > Maybe when I go to Arizona, and they ask for my papers, I can show them
> > this to prove I didn't hop the fence yesterday, and ask them to show me
> > theirs. Forty thousand years! I guess I am as "American" as anybody can
> > get. I knew I was Native American--all I have to do is look in the
> > mirror---and my mother's people-- the Piro-Manso-Tewa- have been in some
> > pueblos in New Mexico that have been continually occupied for over a
> > thousand years, but they have really been there 40,000 years? How do they
> > figure that? Wow!
> >
> > They also sent a graph of "HVR1 Differences from rCRS" (mutations?):
> > 1609C, 16176T, 1628T, 1629C, 16325C, 16327T, and 16519C. I also clicked
> > on "Show All Positions" and I got a very long string of the same thing, but
> > the letters included were A, T, C, and G. Are those haplogroups? What are
> > they?
> >
> > I am not a total dummy, but this DNA stuff has me in a tizzy. What are
> > mutations? What are the differences? Should I care? I tried looking at
> > their tutorials, but I ended up feeling like an imbecile, not understanding
> > a thing. Their website also is very difficult to maneuver. I couldn't
> > find my results until I clicked on dozens of titles.
> >
> > They also sent a list of "matches". Some have Anglo surnames, but their
> > "most distant known female ancestor" are all from New Mexico. The surnames
> > of these ancestors are not in my lines, but they are all common to New
> > Mexico. I guess that just means that no one with my particular surnames
> > submitted their MtDNA.
> >
> > Thank you in advance for any help in understanding this,
> >
> > Emilie
> > Port Orchard, WA
> > -- -- -- -- -- -- -- -- -- -- -- -- --
> > Nuestros Ranchos Announce Mailing List
> >
> > To post, send email to:
> > announce(at)nuestrosranchos.org
> >
> > To change your subscription, log on to:
> > http://www.nuestrosranchos.org
> >